View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_71 (Length: 279)
Name: NF6021_high_71
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 54380065 - 54380319
Alignment:
| Q |
18 |
atgtggagtctgtgaagcaaaggattggatcagagtgtttagtggatgaggctacagggcatgtggcagggaaacctggacaagctaccatgacgggtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54380065 |
atgtggagtctgtgaagcaaaggattggatcagagtgtttagtggatgaggctacagggcatgtggcagggaaacctggacaagctaccatgacgggtct |
54380164 |
T |
|
| Q |
118 |
tccaccaatcagcgcagttcgcttggaacagatgagtaaagcggttcggtggcttgtgattgaattgcagcatggctctggaggacctgctggttcttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54380165 |
tccaccaatcagcgcagttcgcttggaacagatgagtaaagcggttcggtggcttgtgattgaattgcagcatggctctggaggacctgctggttcttct |
54380264 |
T |
|
| Q |
218 |
agttcagctctttcacatccctcggccccttttgatgccaggttttctgatgatg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54380265 |
agttcagctctttcacatccctcggccccttttgatgccaggttttctgaagatg |
54380319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University