View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_83 (Length: 259)
Name: NF6021_high_83
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 14609049 - 14608793
Alignment:
| Q |
1 |
ttataaaatttgaattaacgaaaaaattttgagacagtaaaattgatcatcaaatttgacgtttctaacctttaacgataaaattagagacgaatttgac |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14609049 |
ttataaaatttgaattaacgaaaaa-ttttgagacagtaaaattgatcatcaaatttgacgtctctaacctttaacgataaaattagagacgaatttgac |
14608951 |
T |
 |
| Q |
101 |
aattttttgt--------------agcttttgcaacttttctaataatgatatttgaaagaaaagaataaaaaatatcaatttcgacacacatatataca |
186 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14608950 |
aattttttgtctctaaatttttgtagcttttgcaacttttctaataatgatatttgaaagaaaagaataaaaaatatcaatttcgacacacatatataca |
14608851 |
T |
 |
| Q |
187 |
tgcatacctacactcacatggagtcacatcatgtcccctctcatccctcataatattt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14608850 |
tgcatacctacactcacatggagtcacatcatgtcccctctcatccttcataatattt |
14608793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University