View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_96 (Length: 243)
Name: NF6021_high_96
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 1079621 - 1079843
Alignment:
| Q |
15 |
ctgtgtatagagtgaccggttacaaattcaatcagttgagccggaaattact---------------ttcagaacaaactggtgagtccaaggtgatccc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1079621 |
ctgtgtatagagtgaccggttacaaattcaatcagttgagccggaaattaccggacgccaaattgaattcagaacaaactggtgagtccaaggtgatccc |
1079720 |
T |
 |
| Q |
100 |
gatgccttggtgttctccgaattctagttcaaatgcatggagccaaccaaatttgatccagaagctgaaaaagaggggttatagtggatcaggactggtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079721 |
gatgccttggtgttctccgaattctagttcaaatgcatggagccaaccaaatttgatccagaagctgaaaaagaggggttatagtggatcaggact---- |
1079816 |
T |
 |
| Q |
200 |
aacaaaagcaataacctacaggtgaaaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1079817 |
--taaaagcaataacctacaggtgaaaag |
1079843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University