View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_110 (Length: 227)
Name: NF6021_low_110
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_110 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 39926817 - 39926614
Alignment:
| Q |
1 |
agatctctcactcactcttggcccctccaaaaaacttgttcaaaagtcttgggtgggaattctggaaaatgataacacgtaattaatgtgcaaaaatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39926817 |
agatctctcactcactcttggcccctccaaaaaacttgttcaaaagtcttgggtgggaattctggaaaatgataacacg----taatgtgcaaaaatatt |
39926722 |
T |
 |
| Q |
101 |
taagatctcataaagctgtaccagaattatagatttgaccatagtaagagtagaactatttatttattttaaaatataataaaaaggtagaactacatag |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39926721 |
taagatctcataaagctgtactagaattata-atttgaccatagtaagagtagaactatttatttattttaaaatataataaaaaggtagaactacagag |
39926623 |
T |
 |
| Q |
201 |
gtgcaaatg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
39926622 |
gtgcaaatg |
39926614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University