View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_122 (Length: 206)
Name: NF6021_low_122
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_122 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 15325003 - 15325180
Alignment:
| Q |
18 |
aaaaacgagacataaacatacaactatagcagaatttagaagaaatatctatataatttatgcaatttgaccgattagacctacgaaaattgttcaatag |
117 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
15325003 |
aaaaacgagacataaacacagaactatagcagaatttagaagaaatatctatataatttatgcaatttgaccgattagacctaagaaaattgtttaatag |
15325102 |
T |
 |
| Q |
118 |
gtccctctaaacgtttaaaagcctttgaaaatccaaa-----aatgcctctatcaagaattacaaaccgaaccctctc |
190 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15325103 |
gtccatctaaacgtttaaaggcctttgaaaatccaaaatattaatgcctctatcaagaattacaaaccgaaccctctc |
15325180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University