View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_32 (Length: 399)
Name: NF6021_low_32
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 188 - 382
Target Start/End: Complemental strand, 31792422 - 31792228
Alignment:
| Q |
188 |
aaaccaacagtcaaccttcagttgggacatccattttccgagtctgggaatgaaacatttcaactatatcagcagcagtgctgcattcgtctgggtttct |
287 |
Q |
| |
|
||||||||| |||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792422 |
aaaccaacaatcaatcttcaatttggacatccattttccgagtctgggaatgaaacatttcaactatatcagcagcagtgctgcattcgtctgggtttct |
31792323 |
T |
 |
| Q |
288 |
gtctggcactctgcaaataaatcttggaaatctgatagagatgcctctagaaggatgaaccaaaccaatggcagcatggtgaactggggatactg |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792322 |
gtctgacactctgcaaataaatcttggaaatctgatagagatgcctctagaaggatgaaccaaaccaatggcagcatggtgaactggggatactg |
31792228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University