View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_45 (Length: 357)
Name: NF6021_low_45
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 18 - 333
Target Start/End: Original strand, 24773127 - 24773442
Alignment:
| Q |
18 |
ggatccaatccaacatccttaaccactaccccgccacacaaatcgaagccatttctgtcggaaacgaggttttcgtagacccgaaaaacacgaccaacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24773127 |
ggatccaatccaacatccttaaccactaccccgccacagaaatcgaagccattgctgtcggaaacgaggttttcgtagacccgaaaaacacgaccaacta |
24773226 |
T |
 |
| Q |
118 |
tctcgtacccgccatgaaaaacgttcatgcttctctccaaaaacaaaacctagataaacagattttaatctcttcacccatagcactctctgctttacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
24773227 |
tctcgtacccgccatgaaaaacgttcatgcttctctccaaaaacaaaacctagataaacagattttaatctcttcaccaatagctctctctgctttacaa |
24773326 |
T |
 |
| Q |
218 |
tcttcttaccctacctcatccggttcattcaaaaccgaacttgttgaaccagttattaaaccgatgctcgagtttctacgtcaaaccggttcttatttaa |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24773327 |
tcttcttaccctacctcaaccggttcattcaaaactgaacttgttgaaccggttattaaaccgatgctcgagtttctaagtcaaaccggttcttatttaa |
24773426 |
T |
 |
| Q |
318 |
tggttaacgcttatcc |
333 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24773427 |
tggttaacgcttatcc |
24773442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University