View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_52 (Length: 328)
Name: NF6021_low_52
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 26210033 - 26210343
Alignment:
| Q |
1 |
cagcagcagatgtaacaacaaccaccctgccttgcataagagacaaaaccttcctcattgccacatcaacatccctcctattcctcaacaaaatctcccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210033 |
cagcagcagatgtaacaacaaccaccctgccttgcataagagacaaaacctccctcattgccacatcaacatccctcctattcctcaacaaaatctcccc |
26210132 |
T |
|
| Q |
101 |
cacatgcgccggtgtaagggacccacccgaacgaatacacccttcgattgcctcaaacatcacgtgtgactccagcccaaggtaattctttgccaactcc |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210133 |
cacatgtgccggtgtaagggacccacccgaacgaatacacccttcgattgcctcaaacatcacgtgtgactccagcccaaggtaattctttgccaactcc |
26210232 |
T |
|
| Q |
201 |
ctaaacgcatggaccccacacgtgcttaaactcacgtgcacgtccatgcgtccacacctaactaatgcaggatcaacactatccctatgattagttgtaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210233 |
ctaaacgcatggaccccacacgtgcttaaactcacgtgcacgtccatgcgtccacacctaactaatgcaggatcaacactatccctatgattagttgtaa |
26210332 |
T |
|
| Q |
301 |
aaactactaac |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
26210333 |
aaactactaac |
26210343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University