View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6021_low_58 (Length: 312)

Name: NF6021_low_58
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6021_low_58
NF6021_low_58
[»] chr2 (1 HSPs)
chr2 (1-269)||(14396411-14396669)


Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 14396669 - 14396411
Alignment:
1 tcatggggcgaggatgttacagatgttttgagtttcagagcacatagtatagtgcagactatatttcctgataattggccggatagaaagattcgaagat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||    
14396669 tcatggggcgaggatgttacagatgttttgagtttcagagcacatagt-----gcagactatatttcctgataattggccggatagaaagattcgaagat 14396575  T
101 ttagtacacttactttatattataccatacagtattggaatgtgtgtgccgagccaagaagaaggagcccgaaacactacatgaaatactaacttctgat 200  Q
    ||| ||||||||||||||| |||||     ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
14396574 ttaatacacttactttatactatac-----agtattggaatgtgtgtgccgagccgagaagaaggagcccgaaacaatacatgaaatactaacttctgat 14396480  T
201 atcttccatagatgtttgcttgcatgtgctgctgctgatcaagtactccaaataactcgcactagcagc 269  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14396479 atcttccatagatgtttgcttgcatgtgctgctgctgatcaagtactccaaataactcgcactagcagc 14396411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University