View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_63 (Length: 294)
Name: NF6021_low_63
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 24058437 - 24058705
Alignment:
| Q |
1 |
atatgttatcaattctgaaatgtactgaatttttcctattaactatgctttggagaagtgattgttgagttataaaatagagtggagatgtgatatattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24058437 |
atatgttatcaattctgaaatgtactgaatttttcctattaactatgctttggagatgtgattgttgagttataaaatagagtggagatgtgatatattc |
24058536 |
T |
 |
| Q |
101 |
acataaacggtgagcagtgattagtgtaattttcccatagtaaa-atgtcttaccaactcttataatggcaacataagcaacgtgagggacgtggtggag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24058537 |
acataaacggtgagcagtgattagtgtaattttcccatagtaaacatgtcttaccaactcttataatggcaacataagcaacgtgagggacgtggtggag |
24058636 |
T |
 |
| Q |
200 |
ttccatat-atatcaaacgatgcaagctacaatggtggaagggaatgatcttgtaaatcaactggattg |
267 |
Q |
| |
|
|||||||| | || ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24058637 |
ttccatatcaaattaaatgatgcaagctacaatggtggaagggaatgatcttgtaaatcaattggattg |
24058705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University