View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_80 (Length: 261)
Name: NF6021_low_80
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 78 - 163
Target Start/End: Complemental strand, 1180407 - 1180322
Alignment:
| Q |
78 |
acagaagcccgtgaagatagaagtaacccaaaaaggaaagcccaagcccaacaataagaaaggttgaaatttccaataaatataac |
163 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1180407 |
acagaagcccatgaagatagaagtaacccaaaaaggaaagcccaagcccaacaataagaaaggttgaaatttccaataaatataac |
1180322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 223 - 252
Target Start/End: Complemental strand, 1180262 - 1180233
Alignment:
| Q |
223 |
taacagtaacagtttcaatcttgttcatct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1180262 |
taacagtaacagtttcaatcttgttcatct |
1180233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 3 - 47
Target Start/End: Complemental strand, 19822715 - 19822671
Alignment:
| Q |
3 |
tctctcaccaacttctctcttctctttttcacctcaaccaaacac |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822715 |
tctctcaccaacttctctcttctctttttcacctcaaccaaacac |
19822671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 38782918 - 38782867
Alignment:
| Q |
1 |
tctctctcaccaacttctctcttctctttttcacctcaaccaaacacgggct |
52 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38782918 |
tctctcttaccaacttctctcttctctttttcacctcaaccaaacacaggct |
38782867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 47
Target Start/End: Original strand, 31666561 - 31666593
Alignment:
| Q |
15 |
ttctctcttctctttttcacctcaaccaaacac |
47 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31666561 |
ttctctcttctctatttcacctcaaccaaacac |
31666593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 32819588 - 32819639
Alignment:
| Q |
1 |
tctctctcaccaacttctctcttctctttttcacctcaaccaaacacgggct |
52 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
32819588 |
tctctctcaccaacttctctcttccctttttcacctcaaccaaacacaggct |
32819639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 10365806 - 10365852
Alignment:
| Q |
1 |
tctctctcaccaacttctctcttctctttttcacctcaaccaaacac |
47 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10365806 |
tctctcccaccaacttatctcttctctttttcacctcaaccaaacac |
10365852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 1155762 - 1155716
Alignment:
| Q |
1 |
tctctctcaccaacttctctcttctctttttcacctcaaccaaacac |
47 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1155762 |
tctctctcaccaacttcgctcttctctttttcacctcaaccaaacac |
1155716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 51047404 - 51047358
Alignment:
| Q |
1 |
tctctctcaccaacttctctcttctctttttcacctcaaccaaacac |
47 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
51047404 |
tctctctcgccaacttctctcctctctttttcatctcaaccaaacac |
51047358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 47
Target Start/End: Original strand, 12578071 - 12578103
Alignment:
| Q |
15 |
ttctctcttctctttttcacctcaaccaaacac |
47 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12578071 |
ttctctcttctctatttcacctcaaccaaacac |
12578103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 26939733 - 26939673
Alignment:
| Q |
1 |
tctctctcaccaacttctctcttctctttttcacctcaaccaaacacgggcttagtgtttt |
61 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||| ||||||||||| | |||||||||| |
|
|
| T |
26939733 |
tctctctccccaacttctctcttccttatttcaccccaaccaaacacagtgttagtgtttt |
26939673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University