View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6021_low_82 (Length: 260)

Name: NF6021_low_82
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6021_low_82
NF6021_low_82
[»] chr7 (1 HSPs)
chr7 (119-215)||(2199028-2199124)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 119 - 215
Target Start/End: Original strand, 2199028 - 2199124
Alignment:
119 gtaggaataaaacatcctaatagaaagtattatccgctgtttcaagcagcccactgaaatcctaaacatggcccctggtttttagtttcacttccct 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2199028 gtaggaataaaacatcctaatagaaagtattatccgctgtttcaagcagcccactgaaatcctaaacatggcccctggtttttagtttcacttccct 2199124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University