View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_87 (Length: 256)
Name: NF6021_low_87
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_87 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 50119513 - 50119275
Alignment:
| Q |
18 |
ggattgaattatggaagtggaacattagttagtattgagatagatggggaaccatcaattggtgtctcatatgtgaaagttagtacatctgaacataagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50119513 |
ggattgaattatggaagtggaacattagttagtattgagatagatggggaaccatcaattggtgtctcatatgtgaaagttagtacatctgaacataagt |
50119414 |
T |
|
| Q |
118 |
actttttcaagcaaggagatgaagaaaagaagacagtaatggttggaatcaagggcttgaatattcctgtaggaaaaagatttgctcttacttggaagat |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50119413 |
acttgttcaagcaaggagatgaagaaaagaagacagtaatggttggaatcaagggcttgaatatccctgtaggaaaaagatttgctcttacttggaagat |
50119314 |
T |
|
| Q |
218 |
gggatcataagtttagactatctcatctttattatatct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50119313 |
gggatcataagtttagactatctcatctttattatatct |
50119275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 131 - 225
Target Start/End: Complemental strand, 50109425 - 50109331
Alignment:
| Q |
131 |
aggagatgaagaaaagaagacagtaatggttggaatcaagggcttgaatattcctgtaggaaaaagatttgctcttacttggaagatgggatcat |
225 |
Q |
| |
|
|||||||| ||||||||| | ||| ||||||||||| |||||||| ||||| |||||||| ||||| |||||| | || |||||||||||||||| |
|
|
| T |
50109425 |
aggagatggagaaaagaacatagtgatggttggaatgaagggcttaaatatccctgtaggtaaaagttttgctatgacctggaagatgggatcat |
50109331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University