View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_89 (Length: 251)
Name: NF6021_low_89
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 39140084 - 39140328
Alignment:
| Q |
1 |
tttttgtgctacaaaaagctaatgtaaaataatgtggt---ggaaacctgctaaataatgtgtattttggtaggactctctttctttttaaaatctctaa |
97 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39140084 |
tttttgtgctagaaaaagctaatgtaaaataatgtggtaatggaaacctgctaaataatgtgtactttggtaggactctctttctttttaaaatctctaa |
39140183 |
T |
 |
| Q |
98 |
ttgtaaagtttgaaaaatcatatgacaaatttaacaggactatctctcggcttcttaaccttcctttctatcatattttaattttccagaggcttgaatt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39140184 |
ttgtaaagtttgaaaaatcatatgacaaatttaacaggactatctctcggcttcttaatcttcctttctatcatattttaattttccagaggcttgaatt |
39140283 |
T |
 |
| Q |
198 |
tgttatctagaaacatttcatattcacatgtaacttgagtattat |
242 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39140284 |
tgttacctagaaacatttcatattcacatgtaacttgagtattat |
39140328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 136
Target Start/End: Original strand, 39456928 - 39456988
Alignment:
| Q |
76 |
tctttctttttaaaatctctaattgtaaagtttgaaaaatcatatgacaaatttaacagga |
136 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||| |||||| ||||||||||||| |
|
|
| T |
39456928 |
tcttactttttaaaatatctaattgtaaagtatgaaaaatgatatgataaatttaacagga |
39456988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University