View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_91 (Length: 250)
Name: NF6021_low_91
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_91 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 9668818 - 9668583
Alignment:
| Q |
16 |
atacaaaacgaaaacgccactaacccatcaatgggagcaacactcaaagaacaaaaacacac-tccctctcacctttggataagttggaaatttccttta |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
9668818 |
atacaaaacgaaaacgccactaagccatcaatgggagcaacactcaaagaacgaaaacacacctccctctcacctttggacaagtcggaaatttccttta |
9668719 |
T |
|
| Q |
115 |
gccgaaatgtttttgaagagaagaaaattttgtttcaaggttttattcaaattaagaaagtggaatgtcgatcgaaataccttgatcagcgacatttgca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
9668718 |
gccgaaatgtttttgaagagaagaaaattttgtttcaaggttttattcaagttaagaaagtggaatgtcgatcgaaataccttgatcggcgacatttgta |
9668619 |
T |
|
| Q |
215 |
tggaagtcgaaacaaccgatttccaattttgcttaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9668618 |
tggaagtcgaaacaaccgatttccaattttgcttaa |
9668583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 136
Target Start/End: Original strand, 5142852 - 5142897
Alignment:
| Q |
91 |
tggataagttggaaatttcctttagccgaaatgtttttgaagagaa |
136 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
5142852 |
tggataagtcggaaatttcttttagccgaaatgttcttgaagagaa |
5142897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 141
Target Start/End: Original strand, 7371677 - 7371721
Alignment:
| Q |
97 |
agttggaaatttcctttagccgaaatgtttttgaagagaagaaaa |
141 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
7371677 |
agttagaaatttcctttagccgaaatgttattgaagagaaaaaaa |
7371721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University