View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_92 (Length: 248)
Name: NF6021_low_92
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 36259818 - 36259588
Alignment:
| Q |
1 |
catgttagatccttcggaaaaggtcattccccacttccttctcttgaaggctttgaagatgagaaagaatgcagcaataccggatctgatgatgatgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36259818 |
catgttagatccttcggaaaaggtcattccccacttccttctcttgaaggctttgaagatgagaaagaatgcagcaataccggatctgatgatgatgaag |
36259719 |
T |
 |
| Q |
101 |
ttgctcatgcatgataatgatatggttttaaattgtggttgcggtcacagttacaaacttgtatattgtgataaaatgcaactgatttatgcggtcgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36259718 |
ttgctcatgcatgataatgatatggttttaaattgtggttgcggtcacagttacaaacttgtatattgtgataaaatgcaactgatttatgcggtcgaaa |
36259619 |
T |
 |
| Q |
201 |
ttgtggttatgatgtcataaagacatcaaaa |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
36259618 |
ttgtggttgtgatgtcataaagacatcaaaa |
36259588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University