View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_93 (Length: 248)
Name: NF6021_low_93
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_93 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 26210021 - 26209784
Alignment:
| Q |
1 |
aatgaggagttggcaatgatcggagtgagatcaccagagagtgtgcttctaatgggttcgccggagaattgggactctttgagtgggaagaagaggaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210021 |
aatgaggagttggcaatgatcggagtgaggtcaccagagagtgttcttctaatgggttcaccggagaattgggactctttgagtgggaagaagaggaaag |
26209922 |
T |
|
| Q |
101 |
agcaacaacatgggtccactaatttagataagaaagttaagttttttgtgaggttgaggtcgttgaccaaatctgactctgggagatgatgtttatttta |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26209921 |
agcaacaacatgggtccaataatttagataagaaggttaagttttttgtgaggttgaggtcgttgaccaaatctgactctgggagatgatgtttatttta |
26209822 |
T |
|
| Q |
201 |
agagagaaatttaattcaatgcaactgtgttatgacct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26209821 |
agagagaaatttaattcaatgcaactgtgttatgacct |
26209784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University