View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_low_99 (Length: 243)
Name: NF6021_low_99
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 39954363 - 39954593
Alignment:
| Q |
15 |
tatacgcaaacatggtgacacggtgactttccaacgctagtaaa-----------ccctctaaattcaagttatacaaagggaaaatcacaggcttcgta |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39954363 |
tatacgcaaacatggtgacacagtgactttccaacgctagtaaatcttaatggcaccctctaaattcaagttatacaaagggaaaatcataggcttcgta |
39954462 |
T |
 |
| Q |
104 |
taagttatacatacaataattgaatacgataattttttaagtagattcaaaatataacacatatgaagcata-------tataacaactattcaagaaca |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
39954463 |
taagttatatatacaataattgaatacgataattttttaagtagattcaaaatataacacatatgaagcatatataagttataacaactattcaagacca |
39954562 |
T |
 |
| Q |
197 |
agttgaatatgaaacaagaggacacttacct |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39954563 |
agttgaatatgaaacaagaggacacttacct |
39954593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University