View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6022_low_21 (Length: 239)
Name: NF6022_low_21
Description: NF6022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6022_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 623454 - 623673
Alignment:
| Q |
1 |
tgctatatacaggctggatttctggatggaatcacaaacacagttcctggtactgttgctatttataaatgcttctacaatgtataatcacaattcatgt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
623454 |
tgctatttacaggctggatttctggatggaatcacaaacacagttcctggtactgttgctatttataaatgcttctacaatgtataatcacaattcatgt |
623553 |
T |
|
| Q |
101 |
ttattgattttgctatgactctctatgcagctttgggtggggtaaacctcaaaaaactattggatgatgcaacagatgaaattgggggaaaactgttaga |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
623554 |
ttattgattttgctatga--ctctatgcagctttgggtggggtaaacctcaaaaaactattggatgatgcaacagatgaaattgggggaaaactgttaga |
623651 |
T |
|
| Q |
201 |
ttttaatgacagaatgggtgac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
623652 |
ttttaatgacagaatgggtgac |
623673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University