View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6023_low_10 (Length: 274)
Name: NF6023_low_10
Description: NF6023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6023_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 99 - 180
Target Start/End: Original strand, 44432081 - 44432162
Alignment:
| Q |
99 |
gtccattgatacccactcaatggctgattaatattagccatacatacatattgtattatactataaattaatctttcatgaa |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44432081 |
gtccattgatacccactcaatggctgattaatattagccatacatgcatattgtattatactatacattaatctttcatgaa |
44432162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 44431983 - 44432040
Alignment:
| Q |
1 |
atgacattgcaaatttcccgtgtcactcccactaattgtcattttgaaatctgaagcg |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44431983 |
atgacattgcaaatttcccgtgtcactcccactaattgtcattttgaaatctgaagcg |
44432040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 220 - 274
Target Start/End: Original strand, 44432189 - 44432243
Alignment:
| Q |
220 |
aatagaatttataatttatgaggtgacagaatgaaatgaatgtagaaccctaact |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44432189 |
aatagaatttataatttatgaggtgacagaatgaaatgaatgtagaaccctaact |
44432243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University