View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6023_low_11 (Length: 262)
Name: NF6023_low_11
Description: NF6023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6023_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 246
Target Start/End: Original strand, 43765890 - 43766131
Alignment:
| Q |
5 |
tcaccttcatgttccactagccatgaccaagagaatattaaaagctctttggatttttatactggaatttttggtcttgatgagtcaagaataatggatg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43765890 |
tcaccttcatgttccactagccatgaccaagagaatattaaaagctctttggatttttatactggaattttttgtcttgatgagtcaagaataatggatg |
43765989 |
T |
 |
| Q |
105 |
tagtaaaccaagcaatggaggagcttataaagatggctacaatgggtgaaccaatgtggttacgtagcttagagaccggccgcgaaatacttaactacga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
43765990 |
tagtaaaccaagcaatggaggagcttatcaagatggctacaatgggtgaaccaatgtggttacgtagcttagagaccggtcgcgaaatacttaactatga |
43766089 |
T |
 |
| Q |
205 |
tgaatatatgaaggagtttgcagttgaaaattcagacaatgg |
246 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
43766090 |
tgaatatatgaaggagtttgcagatgaaaattcagaccatgg |
43766131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University