View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6023_low_15 (Length: 241)
Name: NF6023_low_15
Description: NF6023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6023_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 10068463 - 10068681
Alignment:
| Q |
1 |
ctaagttaaggaacatatcatattttttgtcacatgtcatagaaaaagttcatgacttaaaattgaaaaataatcaactaggaaaaccatagatttatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10068463 |
ctaagttaaggaacatatcatattttttgtcacatgtcatagaaaaagctcatgacttaaaattgaaaaataatcaactaggaaaaccatagatttatgc |
10068562 |
T |
 |
| Q |
101 |
ttagtttatatactatatgatgcagtatatcatatattttagtcactcatagtattatggtcatattttgaactactaacttgtgaattcggattccttg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10068563 |
ttagtttatatactatatga-----tatatcatatattttagtcactcatagtattatggtcatattttgaactactaacttgtgaattcggattccttg |
10068657 |
T |
 |
| Q |
201 |
cagtcacggattgttagtagcatt |
224 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
10068658 |
cggtcacggattgttagtagcatt |
10068681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University