View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6023_low_18 (Length: 231)
Name: NF6023_low_18
Description: NF6023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6023_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 33430130 - 33429929
Alignment:
| Q |
14 |
caaaggagaagttaagtgtagatgaactgaattattcatcagagtcccttgcaactagggattattcagcaacagcaagtggttattcatctcgtccagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33430130 |
caaaggagaagttaagtgtagatgaactgaattattcatcagagtcccttgcaactagggattattcagcaacagcaagtggttattcatctcgtccagg |
33430031 |
T |
|
| Q |
114 |
tgaaaatgatacaaagttggataatagtaacattgaagaagcagaatcatctctacgtgaaagtggttatttaaactatgaggttggataaacttatttc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33430030 |
tgaaaatgatacaaagttggataatagtaacattgaagaagcagaatcatctctacgtgaaagtggttatttaaactatgaggttggataaacttatttc |
33429931 |
T |
|
| Q |
214 |
tt |
215 |
Q |
| |
|
|| |
|
|
| T |
33429930 |
tt |
33429929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University