View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6023_low_8 (Length: 305)
Name: NF6023_low_8
Description: NF6023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6023_low_8 |
 |  |
|
| [»] scaffold0232 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 11 - 286
Target Start/End: Original strand, 42392028 - 42392307
Alignment:
| Q |
11 |
acatcatcaaaatgacctagaactaacatccttaaaacaaccttagaaaaggcaagataaacttcaagaagctaagaagggaagccatggaaactgtttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42392028 |
acatcatcaaaatgacctagaactaacatccttaaaactaccttagacaaggcaagataaacttcaagaagctaagaagggaagccatgaaaactgtttg |
42392127 |
T |
 |
| Q |
111 |
agaaactggtaaaataaataaaccgc---nnnnnnnaacacaaaccggttctgaaccggacccaaagcaaacctgaactgtttcgt-nnnnnnnttggtt |
206 |
Q |
| |
|
||||||||||||||| |||||||||| || |||||| ||||||||||||||||||| ||||| |||||| |||||| |||||| |
|
|
| T |
42392128 |
agaaactggtaaaatgaataaaccgcttttttttttaatgcaaaccagttctgaaccggacccaaaacaaacttgaactatttcgtaaaaaaaattggtt |
42392227 |
T |
 |
| Q |
207 |
ttttctgaaacagtttaagaaaccaaaccataaattggatatggtttggtttggtttatgaaccatgcacactcctagtt |
286 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42392228 |
ttttctgaaacaggttaagaaaccaaaccataaattgaatatggtttggtttgatttatgaaccatgcacactcctagtt |
42392307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 283
Target Start/End: Original strand, 4010590 - 4010623
Alignment:
| Q |
250 |
gtttggtttggtttatgaaccatgcacactccta |
283 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
4010590 |
gtttggtttggtttatgaaccatgcacaccccta |
4010623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0232 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0232
Description:
Target: scaffold0232; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 277
Target Start/End: Complemental strand, 21452 - 21423
Alignment:
| Q |
248 |
tggtttggtttggtttatgaaccatgcaca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21452 |
tggtttggtttggtttatgaaccatgcaca |
21423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University