View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6026_high_26 (Length: 338)
Name: NF6026_high_26
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6026_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 16 - 311
Target Start/End: Original strand, 46072762 - 46073063
Alignment:
| Q |
16 |
attttcacaggtgagtctgggtccacaaagttacactctgccttgggagcagaggcagcatattctggtttagatctaggtagttttggtggtatcttga |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46072762 |
attttcacaggtgagtcagggtccacaaagttacactctgccttgggagcagaggcagcatattctggtttagatctaggtaattttggtggtatcttga |
46072861 |
T |
|
| Q |
116 |
aagcgacatttggttcattgct------gctgctgttgttaaattgtttcttgggtttggggacatttgaattctctgattgcaaggaaggtggtggtag |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46072862 |
aagcgacatttggttcattgctgctgctgctgctgttgttaaattgtttcttgggtttggggacattggaattctctgattgcaaggaaggtggtggtag |
46072961 |
T |
|
| Q |
210 |
atttggaacaagaattatagtggctttctgcaatttctttttcttattaccatgggcattattagatttgacctgcaatcaaagacagacatagtatacg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072962 |
atttggaacaagaattatagtggctttctgcaatttctttttcttattaccatgggcattattagatttgacctgcaatcaaagacagacatagtatacg |
46073061 |
T |
|
| Q |
310 |
tg |
311 |
Q |
| |
|
|| |
|
|
| T |
46073062 |
tg |
46073063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University