View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6026_high_32 (Length: 281)
Name: NF6026_high_32
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6026_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 16 - 268
Target Start/End: Complemental strand, 7552510 - 7552258
Alignment:
| Q |
16 |
tcactttcaatttattatagtgtaatgttaatatatcatgtatcaatttcgatttaaccactttcacttgtttataccaatgatgaatataccgatattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7552510 |
tcactttcaatttattatagtgtaatgttaatatatcatgtatcaatttcgatttaactactttcacttgtttataccaatgatgaatataccgatattt |
7552411 |
T |
|
| Q |
116 |
ataaaattattttggtaaattataagggaaagaaagaaaccgttaaataagcaaatgtatcatgcattgtgggactgaggattatattttacataattaa |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7552410 |
ataaaattaatttggtaaattataagggaaagaaagaaaccgttaaataagcaaatgtatcatgcattgtgggactgaggattatattttacataattaa |
7552311 |
T |
|
| Q |
216 |
ttttggaagaatgacggcgctaggcgagcactaatgtgtctgtttgtctgcct |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7552310 |
ttttggaagaatgacggcgctaggcgagcactaatgtgtctgtttgtctgcct |
7552258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University