View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6026_high_43 (Length: 242)
Name: NF6026_high_43
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6026_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 6862405 - 6862629
Alignment:
| Q |
1 |
gattttgggttgaaatatataccttaggatatgccgacgcttggtatcacattaaaaacagacttgtgactgtaaagtaaaggagataatggttgtttat |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6862405 |
gattttgggttgaaatatgtaccttaggatatgccgacgcttggtattacattaaaaacagacttgtgactgtaaagtaaaggagataatggttgtttat |
6862504 |
T |
 |
| Q |
101 |
gtggtgtcattagcacatttgcttataattttctctctttaaattgatactattatatagtatgctgcacttaaatattagtgtgccagattgacatacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6862505 |
gtggtgtcattagcacatttgcttataattttctctctttaaattgatactattatatagtatgctgcacttaaatattagtgtgccagattgatatacg |
6862604 |
T |
 |
| Q |
201 |
ttgccattttgaaacctctaaatgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6862605 |
ttgccattttgaaacctctaaatgt |
6862629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 25 - 126
Target Start/End: Original strand, 6857503 - 6857605
Alignment:
| Q |
25 |
taggatatgccgacgcttggtatcacatta-aaaacagacttgtgactgtaaagtaaaggagataatggttgtttatgtggtgtcattagcacatttgct |
123 |
Q |
| |
|
||||||| ||||||| |||||||||||||| |||||||| | ||||| ||||||| | || |||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
6857503 |
taggatacgccgacggttggtatcacattagaaaacagattagtgacggtaaagtgatggtgataatagttttttatgtggtgtcattagcacatttgct |
6857602 |
T |
 |
| Q |
124 |
tat |
126 |
Q |
| |
|
||| |
|
|
| T |
6857603 |
tat |
6857605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University