View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6026_high_47 (Length: 239)

Name: NF6026_high_47
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6026_high_47
NF6026_high_47
[»] chr3 (1 HSPs)
chr3 (1-238)||(44875594-44875831)


Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 44875594 - 44875831
Alignment:
1 caatagaaaaggagcaacttctgcgcgagaaataagaattgccagtccctccgcaatagctgttttcccaactccagcttcacccagaagaattggattg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44875594 caatagaaaaggagcaacttctgcgcgagaaataagaattgccagtccctccgcaatagctgttttcccaactccagcttcacccagaagaattggattg 44875693  T
101 ctttttgtctttcggcatagtatttgaataattctttgaacttcaacttctcggccaataactggatcaatcagtccagcacttgcgcgggcagtgagat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
44875694 ctttttgtctttcggcatagtatttgaataattctttgaacttcaacttctcggccaataactggatcaatcagtccaacacttgcgcgggcagtgagat 44875793  T
201 ccacgcagaatagtgatagagcactcttcttatctttc 238  Q
    ||||||||||| ||||||||||| ||||||||||||||    
44875794 ccacgcagaattgtgatagagcattcttcttatctttc 44875831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University