View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6026_low_36 (Length: 256)
Name: NF6026_low_36
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6026_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 5 - 241
Target Start/End: Original strand, 29726616 - 29726852
Alignment:
| Q |
5 |
caccaccaataatcaaaaccaagcataaccactatcaacaactaatgtcatgttaatcaaagtgaactaaactaacaagtgaaattaaaatgaccttagg |
104 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29726616 |
caccaccaataatgaaaaccaagcataaccactatcaacaactaatgtcatgttcatcaaagtgaactaaactaacaagtgaaattaaaatgaccttagg |
29726715 |
T |
 |
| Q |
105 |
tcgaatccaattatcggttgagaatgcaaaaacagttagaacctttattccccaactataacacaacatcaccatccttctcaacgactttataccggct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29726716 |
tcgaatccaattatcggttgagaatgcaaaaacagttagaacctttattccccaactataacacaacatcaccatccttctcaacgactttataccggct |
29726815 |
T |
 |
| Q |
205 |
acatgacccgctgatgccggtaaccccctcatctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29726816 |
acatgacccgctgatgccggtaaccccctcatctttg |
29726852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University