View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6026_low_42 (Length: 245)

Name: NF6026_low_42
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6026_low_42
NF6026_low_42
[»] chr2 (2 HSPs)
chr2 (13-226)||(38374290-38374503)
chr2 (25-78)||(35053196-35053249)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 13 - 226
Target Start/End: Complemental strand, 38374503 - 38374290
Alignment:
13 aatatgagttgagaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaagatgataaatatgttttcgtttctatgataaaat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38374503 aatatgagttgagaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaagatgataaatatgttttcgtttctatgataaaat 38374404  T
113 aggaggcaaagaatttcaattaagtctatgttatatattaccggtttgtatcgacccctctcataatatgtnnnnnnntcagattgagagcgaatcaatt 212  Q
    |||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||       |||| |||||||||||||||||    
38374403 aggaggtaaagaatttcaattaagcctatgttatatattaccggtttgtatcgatccctctcataatatgtaaaaaaatcagtttgagagcgaatcaatt 38374304  T
213 tgcatatcgtgctt 226  Q
    ||||||||||||||    
38374303 tgcatatcgtgctt 38374290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 78
Target Start/End: Original strand, 35053196 - 35053249
Alignment:
25 gaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaa 78  Q
    |||||||| |||||||||||||| | | |||||||||||||||  |||||||||    
35053196 gaccaaaattgcaaaaaatgtgaaattagaggaccaaaaagttcaattttaaaa 35053249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University