View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6026_low_49 (Length: 235)
Name: NF6026_low_49
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6026_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 26255446 - 26255243
Alignment:
| Q |
17 |
gaagaacgcgtaggttagctcctgctttccctccggccaccgtggttgaccgggaaagacggtgaagtgtgatactgtatggaaccgcagcttgctgtta |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
26255446 |
gaagaacgcgtaggttagttcctgctttccctccggccaccttggttgaccgggaaacacggtgaagtgtgatactgtatggaaccttagcttgctgtca |
26255347 |
T |
 |
| Q |
117 |
ctgtttgacgttgtttctgtgtccttgccggcgttcatggtagttgtaccgttaatgatatccgctacgccgcaacgtggtagcatgacctgccggagag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26255346 |
ctgtttgacgttgtttctgtgtccttgccggcgttcatggtagttgtaccgttaataatatccgctacgccgcaacgtggtagcatgacctgccggagag |
26255247 |
T |
 |
| Q |
217 |
tcat |
220 |
Q |
| |
|
|||| |
|
|
| T |
26255246 |
tcat |
26255243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University