View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6026_low_51 (Length: 228)
Name: NF6026_low_51
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6026_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 48311133 - 48311036
Alignment:
| Q |
1 |
gttggtatttggggatgataaaatcacgccctattctcactaaaagtgttacctctgcactcatttatactgctgctgatttatcctctcaggtaccc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48311133 |
gttggtatttggggatgataaaatcacgccctattctcactaaaagtgttacctctgcactcatttatactgctgctgatttatcctctcaggtaccc |
48311036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 136 - 223
Target Start/End: Complemental strand, 48310998 - 48310912
Alignment:
| Q |
136 |
cttgtctgcattcattggtttgggttcaaaaggaacattttttagttgatgtttgttataattgttcacttggttgtcctatgcttct |
223 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
48310998 |
cttgtctgcattcattgatttgggttcaaaaggaac-ttttttagttgatgtttgttacaattgttcacttggttgtcttatgtttct |
48310912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University