View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6026_low_54 (Length: 206)
Name: NF6026_low_54
Description: NF6026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6026_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 48311335 - 48311193
Alignment:
| Q |
19 |
atgaccatgcaaatgttcactaaccattccattaatcaaatcaaacttcattctaacaaacactattcaaaaccttactttcgattacctaataatttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48311335 |
atgaccatgcaaatgttcactaaccattccattaatcaaatcaaacttcattctaacaaacactattcaaaaccttactttcgattacctaataatttct |
48311236 |
T |
|
| Q |
119 |
tcaccnnnnnnnccagacattgtgaaatttctccatcatcgtt |
161 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
48311235 |
tcaccaaaaaaaccagacagtgtgaaatttctccatcatcgtt |
48311193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University