View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6027_low_1 (Length: 277)
Name: NF6027_low_1
Description: NF6027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6027_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 46 - 188
Target Start/End: Complemental strand, 1965008 - 1964866
Alignment:
| Q |
46 |
gttgttatcatccctccgatttctacggaaagggaccatagtaaccatgagataaactgcaatataagaaaaatctgacaaaatatcatttcatctaaaa |
145 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965008 |
gttgttgttatccctccgatttctacggaaagagaccatagtaaccatgagatagactgcaatataagaaaaatctgacaaaatatcatttcatctaaaa |
1964909 |
T |
 |
| Q |
146 |
attaaactcacgtaagttcttctatatgttccattaagatgtg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1964908 |
attaaactcacgtaagttcttctatatgttccattaagatgtg |
1964866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 259
Target Start/End: Complemental strand, 1964418 - 1964382
Alignment:
| Q |
223 |
ttacctaatttataatccatttttcactttgtcatcc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1964418 |
ttacctaatttataatccatttttcactttggcatcc |
1964382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University