View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6028_high_4 (Length: 365)
Name: NF6028_high_4
Description: NF6028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6028_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 11 - 347
Target Start/End: Complemental strand, 4261217 - 4260881
Alignment:
| Q |
11 |
atcatcatcttcgattaaactttcttcattttgacttcatgaatcttcattcattaacttggactgtgaactttgagtttctgcattttatgattgtttt |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261217 |
atcattatcttcgattaaactttcttcattttgacttcatgaatcttcattcattaacttggactgtgaactttgagtttctgcattttatgattgtttt |
4261118 |
T |
 |
| Q |
111 |
ctatgattgttttctggataatgttgtcaattgcggattgcacaaaatagcagtttgttcgtattccactactatttgacacactttggactgaatcata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261117 |
ctatgattgttttctggataatgttgtcaattgcggattgcacaaaatagcagtttgttcgtattccactactatttgacacactttggactgaatcata |
4261018 |
T |
 |
| Q |
211 |
gtgcaggacggaacactagctttgttcaaattccgcgatgctaaagcattatagcattgctatagcagctatttgacaaccctaaatgatatgttacgat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261017 |
gtgcaggacggaacactagctttgttcaaattccgcgatgctaaagcattatagcattgctatagcagctatttgacaaccctaaatgatatgttacgat |
4260918 |
T |
 |
| Q |
311 |
ttttatgattattgtttcaagttgaagcatattagca |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4260917 |
ttttatgattattgtttcaagttgaagcatattagca |
4260881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 170
Target Start/End: Original strand, 2316933 - 2316973
Alignment:
| Q |
130 |
aatgttgtcaattgcggattgcacaaaatagcagtttgttc |
170 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2316933 |
aatgttgtcaattgcagatcgcacaaaatagcagtttgttc |
2316973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 30617190 - 30617240
Alignment:
| Q |
132 |
tgttgtcaattgcggattgcacaaaatagcagtttgttcgtattccactac |
182 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |||||||| |||||||||| |
|
|
| T |
30617190 |
tgttgtcaattggggattgcagaaaatagcggtttgttcaaattccactac |
30617240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 289
Target Start/End: Complemental strand, 42440203 - 42440145
Alignment:
| Q |
231 |
tttgttcaaattccgcgatgctaaagcattatagcattgctatagcagctatttgacaa |
289 |
Q |
| |
|
|||||||||||||||| |||||| || |||||||| ||||||||| ||||||||||| |
|
|
| T |
42440203 |
tttgttcaaattccgctatgctacagtgttatagcactgctatagcctctatttgacaa |
42440145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University