View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6028_high_6 (Length: 330)
Name: NF6028_high_6
Description: NF6028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6028_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 21 - 330
Target Start/End: Original strand, 36998487 - 36998796
Alignment:
| Q |
21 |
gaggaaaacaaacatacgaccacataaactaaaccttattttgtgtgtaatgaagcagttagctatcattgtattcatttataagtaccaccagtggtat |
120 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36998487 |
gaggaaaacaaacatacaaccacataaactaaaccttattttgtgtgtaatgaagcagttagctatcattgtattcatttataagtaccaccagtggtgt |
36998586 |
T |
 |
| Q |
121 |
accctgtggcatttggatttccaccaacacgggtattatgggccgtggcggtcccatctgtgcctctattagtcccaatagggtgtgagcccaccacacc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998587 |
accctgtggcatttggatttccaccaacacgggtattatgggccgtggcggtcccatctgtgcctctattagtcccaatagggtgtgagcccaccacacc |
36998686 |
T |
 |
| Q |
221 |
gtcgacgacatggcccgtgggctgtccagttccatgaccaggcatggctgacatctgatgtgccccagtgggatgtccataattcccagtggtagagtat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998687 |
gtcgacgacatggcccgtgggctgtccagttccatgaccaggcatggctgacatctgatgtgccccagtgggatgtccataattcccagtggtagagtat |
36998786 |
T |
 |
| Q |
321 |
gtggcggtcc |
330 |
Q |
| |
|
|||||||||| |
|
|
| T |
36998787 |
gtggcggtcc |
36998796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University