View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6028_low_8 (Length: 277)
Name: NF6028_low_8
Description: NF6028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6028_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 258
Target Start/End: Original strand, 39062929 - 39063173
Alignment:
| Q |
17 |
atgaaaccatacacttttggttaaatattttgaagttcattaagcgataaattcagaatccactaccacgagttcattgtgtttgcctc---atcaactc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39062929 |
atgaaaccatacacttttggttaaatattttgaagttcattaagcgataaattcagaatccactaccacgagttcattgtgtttgcctcgtcatcaactc |
39063028 |
T |
|
| Q |
114 |
aatatgctattgtaatcatcttattgttaccatccttataaactactaactttgaaaatcccccttttcttaaagcagacatctaatccaatgatatgcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39063029 |
aatatgctattgtaatcatcttattgttaccatccttgtaaactactaactttgaaaatcccccttttcttaaagcagacatctaatccaatgatatgcc |
39063128 |
T |
|
| Q |
214 |
tacatcattagaggattttctttcatttgatatatttgcggcatg |
258 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39063129 |
tacatcactagaggattttctttcctttgatatatttgcggcatg |
39063173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University