View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6029_high_22 (Length: 255)
Name: NF6029_high_22
Description: NF6029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6029_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 62 - 234
Target Start/End: Complemental strand, 44968956 - 44968784
Alignment:
| Q |
62 |
ctttagggcatacaatataagaacgacctgatattattgagtagtactatgatattaagggctgctctgcgcagtgatcagcgccatgaacactaagatt |
161 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44968956 |
ctttagggtatacaatataagaacgacctgatattattgagtagtactatgatattaagggctgctctgcgcagtgatcagcgccatgaacactaagatt |
44968857 |
T |
 |
| Q |
162 |
ccgactgtctaaactaatgaagcacttgtccaattccagcagacccttacaatgttcaccaaattgtttggct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44968856 |
ccgactgtctaaactaatgaagcacttgtccaattccagcagacccttacaacgttcaccaaattgtttggct |
44968784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University