View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6029_high_30 (Length: 244)
Name: NF6029_high_30
Description: NF6029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6029_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 236
Target Start/End: Original strand, 3962450 - 3962666
Alignment:
| Q |
20 |
tgtgaacactaaatctaggtcttattctgatcgtttgtgtcttcgggttttttcgggtgattgatagaattgtgggttgttgcgagttagaacttgaagc |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
3962450 |
tgtgaacactaaatctaagtcttattctgatcgtttgtgtcttcgggttttttcgggtgattggtagaattgtgggttgttgcgggttagagcttgaagc |
3962549 |
T |
 |
| Q |
120 |
ttgttacatccaaaatttcaataatctagacattttttcattctaaaacaatgtaacctcgtaaaattacacatagcactaatgagttgaagaaataaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3962550 |
ttgttacatccaaaatttcaataatctagacattttctcattctaaaacaatgtaacctcgtaaaattatacatagcactaatgagttgaagaaataaat |
3962649 |
T |
 |
| Q |
220 |
taacaatagatttaatt |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3962650 |
taacaatagatttaatt |
3962666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University