View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6029_high_33 (Length: 239)
Name: NF6029_high_33
Description: NF6029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6029_high_33 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 40285949 - 40285729
Alignment:
| Q |
18 |
tggacatcatattagataaaacatgggttatataacgactttgaaactcttgatttgtcagcttgttctaggtaacacagtggttttaatacnnnnnnna |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40285949 |
tggacatcatat-agataaaacatgggttatataacgactttgaaactcttgatttgtcagcttgttctaggtaacacagtggttttaatacttttttta |
40285851 |
T |
 |
| Q |
118 |
tgaggtgaggaagaagtgaaaattttaatttgagtggttaaaacatacatgcaggtttctttcagaacttcaagttttggtgcaatttctgtgggatgta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40285850 |
tgaggtgaggaagaagtgaaaattttaatttgagtggttaaaacatacatgcaggtttctttcagaacttcaagttttggtgcaatttctgtgggatgta |
40285751 |
T |
 |
| Q |
218 |
cagggagaagctttccttcgtt |
239 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
40285750 |
caaggagaagctttccttcgtt |
40285729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University