View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6029_high_36 (Length: 202)
Name: NF6029_high_36
Description: NF6029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6029_high_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 7044543 - 7044360
Alignment:
| Q |
1 |
attaacatcaaaggccttgccggaagttttgcaacacttgccaattggttcttttcgtggttgattacattgacagcaaatttgctcttggattggagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7044543 |
attaacatcaaaggccttgccggaagttttgcaacacttgccaattggttcttttcgtggttgattacattgacagcaaatttgctcttggattggagtt |
7044444 |
T |
|
| Q |
101 |
ctggaggtttgtgtgcattgtccaagttatatttttctcgaaatatctttgttatttgttgctaaccagaagcttcttttgttc |
184 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7044443 |
ctggaggtttgtgtgcattgtccgagttatatttttctcgaaatatctttgttatttgttgctaaccagaagcttcttttgttc |
7044360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University