View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6029_low_26 (Length: 248)
Name: NF6029_low_26
Description: NF6029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6029_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 221
Target Start/End: Original strand, 8943572 - 8943779
Alignment:
| Q |
14 |
tgaaatgaaactacaagatcctttatgaaactatttgcaatcattaatgtgtaaaagagtatgttcatgcatattgcataccacaattgatactaaaagc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8943572 |
tgaaatgaaactacaagatcctttatgaaactatttgtaatcattaatgtgtaaaagagtatgttcatgcatattgcataccacaattgatactaacagc |
8943671 |
T |
|
| Q |
114 |
cctaccccacataatccatattccatgtttagctctctgcttggttttgttttgtattggtgttggagtaggttttgtattttaagaactctaataatac |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8943672 |
cctaccccacataatccatattacatgtttagctctctgcttggttttattttgtattggtgtcggagtaggttttgtattttaagaactctaataatac |
8943771 |
T |
|
| Q |
214 |
aacaaagt |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
8943772 |
aacaaagt |
8943779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University