View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6029_low_29 (Length: 245)
Name: NF6029_low_29
Description: NF6029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6029_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 43 - 154
Target Start/End: Complemental strand, 3963550 - 3963439
Alignment:
| Q |
43 |
caaagacccacataagacaaagaaaataacaacaccgcactacgatgaagaaatccaagaaaagacattaaaaagggacttaatttatgtaaagatcact |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3963550 |
caaagacccacataagacaaagaaaataacaacaccgcactacgatgaagaaatcctagaaaagacattaaaaagggacttaatttatttaaagatcacc |
3963451 |
T |
|
| Q |
143 |
tatttaaattaa |
154 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3963450 |
tatttaaattaa |
3963439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 146 - 245
Target Start/End: Complemental strand, 3963052 - 3962953
Alignment:
| Q |
146 |
ttaaattaaaagaggtaaaagatacacgtaggtgatttgaattcaaaaaatgacctaaaaccacatattttggctgctgttttcattggtgcgttgcttc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| | |||||||| |
|
|
| T |
3963052 |
ttaaattaaaagaggtaaaagatacacgtaggtgatttgaattcaaaaaataatctaaaaccacgtattttggctgctgttttcattggggtgttgcttc |
3962953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University