View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6029_low_35 (Length: 236)
Name: NF6029_low_35
Description: NF6029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6029_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 29050935 - 29050721
Alignment:
| Q |
13 |
attttaccccatcattcatggttgaagttgcatgtgcatgatcctcaatcttcaaaaccttgaagggataggtacagtaacagctcattgcttgagtcaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29050935 |
attttaccccatcattcatggttgaagttgcatgtgcat--------atcttcaaaaccttgaagggataggtacagtaacagctcattgcttgagtcaa |
29050844 |
T |
 |
| Q |
113 |
ttatgtaagcattttctactttatggtaaacaggaatttcctcgtagacaaagttgttacacaaacaaggctttttatccataaagttacatgattgaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29050843 |
ttatgtaagcattttctactttatggtaaacaggaatttcctcgcagacaaagttgttacacaaacaaggctttttatccataaagttacatgattgaac |
29050744 |
T |
 |
| Q |
213 |
atgtgcatttcatcatcaatgat |
235 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29050743 |
atgtgcatttcatcatcaatgat |
29050721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 114 - 236
Target Start/End: Complemental strand, 29054028 - 29053905
Alignment:
| Q |
114 |
tatgtaagcattttctactttatggtaaacagg-aatttcctcgtagacaaagttgttacacaaacaaggctttttatccataaagttacatgattgaac |
212 |
Q |
| |
|
|||||||||| ||||||||||||| | | ||| |||| ||| |||| ||| |||||||| |||||||||||||||| | |||||||||| ||||| |
|
|
| T |
29054028 |
tatgtaagcactttctactttatgattataagggaattcccttatagataaaattgttacattgacaaggctttttatccggagagttacatgaatgaac |
29053929 |
T |
 |
| Q |
213 |
atgtgcatttcatcatcaatgatt |
236 |
Q |
| |
|
|| ||||||| ||||||||||||| |
|
|
| T |
29053928 |
atctgcatttaatcatcaatgatt |
29053905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University