View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6029_low_38 (Length: 202)

Name: NF6029_low_38
Description: NF6029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6029_low_38
NF6029_low_38
[»] chr1 (1 HSPs)
chr1 (1-184)||(7044360-7044543)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 7044543 - 7044360
Alignment:
1 attaacatcaaaggccttgccggaagttttgcaacacttgccaattggttcttttcgtggttgattacattgacagcaaatttgctcttggattggagtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7044543 attaacatcaaaggccttgccggaagttttgcaacacttgccaattggttcttttcgtggttgattacattgacagcaaatttgctcttggattggagtt 7044444  T
101 ctggaggtttgtgtgcattgtccaagttatatttttctcgaaatatctttgttatttgttgctaaccagaagcttcttttgttc 184  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7044443 ctggaggtttgtgtgcattgtccgagttatatttttctcgaaatatctttgttatttgttgctaaccagaagcttcttttgttc 7044360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University