View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6030_high_5 (Length: 316)
Name: NF6030_high_5
Description: NF6030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6030_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 5 - 301
Target Start/End: Original strand, 41649059 - 41649355
Alignment:
| Q |
5 |
gagtagcatagggaatgtgaaatataagttttgccccacttgtaattgtttcagttatgaaatggaatttaatttacaaattagagccctccttgatttg |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41649059 |
gagtagtatagggaatgtgaaatataagttttgccccacttgtaattgtttcagttatgaaatggaatttaatttacaaattatagccctccttgatttg |
41649158 |
T |
 |
| Q |
105 |
aagtgatagcttacgtatacgttattttacctatacacacagtgtaatttatatctggttggaagttatcataactgcttaatatgcttgcttgattgcc |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649159 |
aagtgatagcttacatatacgttattttacctatacacacagtgtaatttatatctggttggaagttatcataactgcttaatatgcttgcttgattgcc |
41649258 |
T |
 |
| Q |
205 |
aatagaggttgatccattggatgatactgtttgtgatataccagccttagggactaaacaacaatcaccaaaattcaaacttttggactgagattct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649259 |
aatagaggttgatccattggatgatactgtttgtgatataccagcctaagggactaaacaacaatcaccaaaattcaaacttttggactgagattct |
41649355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University