View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6030_high_7 (Length: 265)
Name: NF6030_high_7
Description: NF6030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6030_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 44489687 - 44489924
Alignment:
| Q |
13 |
atcatcaacttgggaggtgtagagagtttcattagtatttttgagtgcaacataattggattttgataagtattgggaggtgagttgggagagaaataaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44489687 |
atcatcaacttgggaggtgtagagagtttcattagtatttttgagtgcaacataattggattttgataagtattgtgaggtgagttgggagagaaataaa |
44489786 |
T |
|
| Q |
113 |
caatctttgagagcatttattgcctctttggtaaaagtagactcaagatagaagttcaatgagttcaaaaacttttgggactgaaacatggatttttgaa |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44489787 |
caatctttgagagcatttattgtctctttggtaaaagtagactcaagatagaagttcaatgagttcaaaaatttttgggactgaaacatggatttttgaa |
44489886 |
T |
|
| Q |
213 |
ttgagaatctagcaaagtcatggactttggcattttgt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44489887 |
ttgagaatctagcaaagtcatggactttggcattttgt |
44489924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University