View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6031_low_7 (Length: 221)
Name: NF6031_low_7
Description: NF6031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6031_low_7 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 40 - 221
Target Start/End: Original strand, 3302332 - 3302512
Alignment:
| Q |
40 |
cttttttatgtttcatatccattcattaacttatttgacttctaatgtggattatttggatttactttgtggttaattaggactaattaggtgttaatta |
139 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3302332 |
cttttttatgtt-catatccattcattaatttatttgacttctaatgtggattatttggatttactttgtggttaattaggactaattaggtgttaatta |
3302430 |
T |
|
| Q |
140 |
gctatattataggttagtaatgaaagtttaaatccatattattaggtatagaactttcaaatgtcaataaataacaatggac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3302431 |
gctatattataggttagtaatgaaagtttaaatccctattattaggtatagaactttcaaatgtcaataaataacaatggac |
3302512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University