View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_high_15 (Length: 381)
Name: NF6033_high_15
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 208 - 362
Target Start/End: Complemental strand, 44093203 - 44093049
Alignment:
| Q |
208 |
agtatgcatgacaaaacaattgcattcattgggtagacaacagtttcaatctatgatgtgtatggtcactggtggacttgagaggccagaagttgaaaat |
307 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44093203 |
agtatgcatgacaaaacaattgcattcgttgggtagacaacagtttcaatctatgatgtgtatggtcactggtggacttgagaggccagaagttgaaaat |
44093104 |
T |
|
| Q |
308 |
gttggatggtaatatggtcttgtaaaagcacgtggagctattattcctgacggat |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44093103 |
gttggatggtaatatggtcttgtaaaagcacgtggagctattattcctgacggat |
44093049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 231 - 334
Target Start/End: Complemental strand, 39278738 - 39278635
Alignment:
| Q |
231 |
attcattgggtagacaacagtttcaatctatgatgtgtatggtcactggtggacttgagaggccagaagttgaaaatgttggatggtaatatggtcttgt |
330 |
Q |
| |
|
|||||||||| | ||||| ||||||||| |||||||||||| |||||||||| ||||| ||||||||| ||||||| |||||| | |||| |||||| |
|
|
| T |
39278738 |
attcattgggccgtcaacaatttcaatctctgatgtgtatggccactggtggagaagagagtccagaagttcaaaatgtgggatgggagtatgatcttgt |
39278639 |
T |
|
| Q |
331 |
aaaa |
334 |
Q |
| |
|
|||| |
|
|
| T |
39278638 |
aaaa |
39278635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University