View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_high_40 (Length: 241)
Name: NF6033_high_40
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 91 - 231
Target Start/End: Complemental strand, 27315409 - 27315268
Alignment:
| Q |
91 |
gattcactacttttagtaaagttgttctccttccaaattactccaatgtcaatcaagctggaacttcat-ttttatgatgttcctatctgctgactagta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27315409 |
gattcactacttttagtaaagttgttctccttccaaattactccaatgtcaatcaagctggaacttcattttttatgatgttcctatctgctgactagta |
27315310 |
T |
|
| Q |
190 |
ttctatgctattattatgctatattaatgctaaagctgatga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27315309 |
ttctatgctattattatgctatattaatgctaaagctaatga |
27315268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 27315484 - 27315435
Alignment:
| Q |
17 |
ataacttgcacatattggcataaatatcataaggatcctgtgcgttttac |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27315484 |
ataacttgcacatattggcataaatatcataaggatcctgtgcgttttac |
27315435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University